Skip to main content
Addgene

lentiGuide-RRBP1-1
(Plasmid #92156)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92156 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 8302
  • Total vector size (bp) 8322
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RRBP1 sgRNA-1
  • gRNA/shRNA sequence
    ACAGGAGCAACGATAATGGG
  • Species
    H. sapiens (human)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer hU6-F
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuide-RRBP1-1 was a gift from Alice Ting (Addgene plasmid # 92156 ; http://n2t.net/addgene:92156 ; RRID:Addgene_92156)

  • For your References section:

    Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Hung V, Lam SS, Udeshi ND, Svinkina T, Guzman G, Mootha VK, Carr SA, Ting AY. Elife. 2017 Apr 25;6. pii: e24463. doi: 10.7554/eLife.24463. 10.7554/eLife.24463 PubMed 28441135
Related items:
Commonly requested with: