Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shNg pA_RC3J1_CAGW
(Plasmid #92155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92155 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    unknown
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA targeting Ng
  • Alt name
    neurogranin
  • gRNA/shRNA sequence
    GATGCCCGTGACAAGACTTCCCTACTGTTTCAAGAGAACAGTAGGGAAGTCTTGTCACTTTTTGGAAA
  • Species
    H. sapiens (human)
  • Promoter H1

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shNg pA_RC3J1_CAGW was a gift from Weifeng Xu (Addgene plasmid # 92155 ; http://n2t.net/addgene:92155 ; RRID:Addgene_92155)
  • For your References section:

    Experience-Dependent Equilibration of AMPAR-Mediated Synaptic Transmission during the Critical Period. Han KS, Cooke SF, Xu W. Cell Rep. 2017 Jan 24;18(4):892-904. doi: 10.1016/j.celrep.2016.12.084. 10.1016/j.celrep.2016.12.084 PubMed 28122240