Skip to main content
Addgene

pLQ-Pxyl/tet-cas9-Pj23119-sgRNA
(Plasmid #92121)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92121 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    unknown
  • Total vector size (bp) 4000
  • Modifications to backbone
    ColE1 origin, AmpR, Rep(+), cat resistance
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    High copy in S. aureus, low copy in S. aureus. chloramphenicol resistance in S. aureus
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9-Pxyltet-sgRNA-pj23119
  • gRNA/shRNA sequence
    atgtgttcgtatgttactgc
  • Species
    S. pyogenes (cas9)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's QC result finds some discrepancies in the Cas9; the depositor notes the plasmid is still functional

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLQ-Pxyl/tet-cas9-Pj23119-sgRNA was a gift from Sheng Yang (Addgene plasmid # 92121 ; http://n2t.net/addgene:92121 ; RRID:Addgene_92121)

  • For your References section:

    CRISPR/Cas9-based efficient genome editing in Staphylococcus aureus. Liu Q, Jiang Y, Shao L, Yang P, Sun B, Yang S, Chen D. Acta Biochim Biophys Sin (Shanghai). 2017 Sep 1;49(9):764-770. doi: 10.1093/abbs/gmx074. 10.1093/abbs/gmx074 PubMed 28910979
Related items:
Commonly requested with: