pET-dSpCas9-HF1-VP64-6xHis
(Plasmid #92118)

• Purpose: Expression of dead/inactive increased fidelity SpCas9-HF1-VP64-6xHis in bacterial cells
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.

Backbone

• Vector backbone: pET29
• Total vector size (bp): 9544
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: dead/inactive SpCas9-HF1-NLS-3xFLAG-VP64
• Alt name: dead/inactive high-fidelity SpCas9-HF1-NLS-3xFLAG-VP64
• Species: S. pyogenes
• Insert Size (bp): 4404
• Mutation: D10A, N497A, R661A, Q695A, H840A, Q926A
• Promoter: T7
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xFLAG (C terminal on insert)
  • VP64 (C terminal on insert)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GCAAATTGGAGATCAATATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: pT7-dead SpCas9-HF1-NLS-3xFLAG-VP64-6xHis (without U6-sgRNA coding sequence).

For detailed information and plasmid usage, please see the associated publication.