pX330-Flag-deSpCas9
(Plasmid #92114)

• Purpose: Expression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.

Backbone

• Vector backbone: pX330-like (without U6-sgRNA coding sequence)
• Total vector size (bp): 8074
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dead/inactive eSpCas9 with FLAG tag
• Alt name: dead/inactive eSpCas9 (1.1) with FLAG tag
• Species: S. pyogenes
• Insert Size (bp): 4272
• Mutation: D10A, H840A, K848A, K1003A, R1060A
• Promoter: Cbh
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: gggtggagtatttacggtaaactgcccacttgg
• 3′ sequencing primer: CGGCGTACTGGTCGCCGATC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: pCbh-3xFLAG-NLS-deSpCas9 (1.1)-NLS (without U6-sgRNA coding sequence).

For detailed information and plasmid usage, please see the associated publication.