Skip to main content
Addgene

HeFm1SpCas9
(Plasmid #92110)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92110 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330-like (without U6-sgRNA coding sequence)
  • Total vector size (bp) 8077
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
  • Alt name
    pX330-Flag-HeFm1SpCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4272
  • Mutation
    R661A, Q695A, K848A, Q926A, K1003A, R1060A
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAGGGATGGTTGGTTGGTGG
  • 3′ sequencing primer GGAAAGGACAGTGGGAGTGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pCbh-3xFLAG-NLS-HeFm1SpCas9-NLS (without U6-sgRNA coding sequence).

Highly enhanced Fidelity nuclease variant HeFm1SpCas9 contains mutations from both eSpCas9 (1.1) and SpCas9-HF1.

HeFSpCas9s exhibits activity with spectacularly increased specificity specifically for those targets that are met with higher off-target propensity by eSpCas9 (1.1) and SpCas9-HF1.

The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).

For detailed information and plasmid usage, please see the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HeFm1SpCas9 was a gift from Ervin Welker (Addgene plasmid # 92110 ; http://n2t.net/addgene:92110 ; RRID:Addgene_92110)

  • For your References section:

    Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Kulcsar PI, Talas A, Huszar K, Ligeti Z, Toth E, Weinhardt N, Fodor E, Welker E. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. 10.1186/s13059-017-1318-8 [pii] PubMed 28985763
Related items: