pX330-Flag-SpCas9-HF1 (without sgRNA)
(Plasmid #92102)

• Purpose: Expression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.

Backbone

• Vector backbone: pX330-like (without U6-sgRNA coding sequence)
• Total vector size (bp): 8077
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
• Alt name: Flag-SpCas9-HF1
• Species: S. pyogenes
• Insert Size (bp): 4272
• Mutation: N497A, R661A, Q695A, Q926A
• Promoter: Cbh
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGAAGCAGCGGACCTTCGAC
• 3′ sequencing primer: GGAAAGGACAGTGGGAGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pCbh-3xFLAG-NLS-SpCas9-HF1-NLS (without U6-sgRNA coding sequence).
SpCas9-HF1 subcloned in the same plasmid backbone and tailored to identically possess the same NLS and FLAG tags at their termini like the eSpCas9 (without U6-sgRNA coding sequence) (Addgene #92354).
The expression level of SpCas9-HF1 is higher from this than from the original plasmid (VP12; Addgene #72247).

The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).

For plasmid usage and detailed informations, please see the associated publication.