TAF3 PHD_pGEX-6P-2
(Plasmid
#92100)
-
PurposeExpresses GST fusion TAF3 PHD domain protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-6P-2
- Backbone size w/o insert (bp) 4985
- Total vector size (bp) 5191
-
Vector typeBacterial Expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21 Codon plus strain should be used for expression
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAF3 PHD domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)227
-
GenBank IDNM_031923.1
-
Entrez GeneTAF3 (a.k.a. TAF140, TAFII-140, TAFII140)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- GST Tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
overexpressing at 20°C in the presence of 50 μM zinc in LB medium
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TAF3 PHD_pGEX-6P-2 was a gift from Albert Jeltsch (Addgene plasmid # 92100 ; http://n2t.net/addgene:92100 ; RRID:Addgene_92100) -
For your References section:
Application of recombinant TAF3 PHD domain instead of anti-H3K4me3 antibody. Kungulovski G, Mauser R, Reinhardt R, Jeltsch A. Epigenetics Chromatin. 2016 Mar 22;9:11. doi: 10.1186/s13072-016-0061-9. eCollection 2016. 61 [pii] PubMed 27006701