TAF3 PHD_pGEX-6P-2
(Plasmid #92100)

• Purpose: Expresses GST fusion TAF3 PHD domain protein
• Depositing Lab: Albert Jeltsch
• Publication: Kungulovski et al Epigenetics Chromatin. 2016 Mar 22;9:11. doi: 10.1186/s13072-016-0061-9. eCollection 2016.

Backbone

• Vector backbone: pGEX-6P-2
• Backbone size w/o insert (bp): 4985
• Total vector size (bp): 5191
• Vector type: Bacterial Expression
• Selectable markers: Chloramphenicol

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: BL21 Codon plus strain should be used for expression
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TAF3 PHD domain
• Species: H. sapiens (human)
• Insert Size (bp): 227
• GenBank ID: NM_031923.1
• Entrez Gene: TAF3 (a.k.a. TAF140, TAFII-140, TAFII140)
• Promoter: tac promoter
• Tag / Fusion Protein:
  • GST Tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

overexpressing at 20°C in the presence of 50 μM zinc in LB medium