Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TAF3 PHD_pGEX-6P-2
(Plasmid #92100)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92100 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6P-2
  • Backbone size w/o insert (bp) 4985
  • Total vector size (bp) 5191
  • Vector type
    Bacterial Expression
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21 Codon plus strain should be used for expression
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAF3 PHD domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    227
  • GenBank ID
    NM_031923.1
  • Entrez Gene
    TAF3 (a.k.a. TAF140, TAFII-140, TAFII140)
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST Tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

overexpressing at 20°C in the presence of 50 μM zinc in LB medium

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TAF3 PHD_pGEX-6P-2 was a gift from Albert Jeltsch (Addgene plasmid # 92100 ; http://n2t.net/addgene:92100 ; RRID:Addgene_92100)
  • For your References section:

    Application of recombinant TAF3 PHD domain instead of anti-H3K4me3 antibody. Kungulovski G, Mauser R, Reinhardt R, Jeltsch A. Epigenetics Chromatin. 2016 Mar 22;9:11. doi: 10.1186/s13072-016-0061-9. eCollection 2016. 61 [pii] PubMed 27006701