lentiMPH v2 (Neo)
(Plasmid #92065)

• Purpose: Modified version of lentiMPH v2, a lenti vector encoding the MS2-P65-HSF1 activator helper complex and neo resistance marker (EF1a-MS2-p65-HSF1-2A-Neo-WPRE).
• Depositing Lab: Adam Karpf
• Publication: Barger et al Elife. 2021 Apr 23;10. pii: 55070. doi: 10.7554/eLife.55070.

Backbone

• Vector backbone: lentiMPH v2
• Backbone manufacturer: Feng Zhang lab
• Total vector size (bp): 11505
• Modifications to backbone: Removed T2A-Hygro by digestion with Bsp1407I and EcoRI. Added T2A-Neo by PCR amplification and ligation into these restriction sites.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MS2-P65-HSF1_2A_Neo
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2526
• Mutation: N55K in MS2
• Entrez Gene: HSF1 (a.k.a. HSTF1)
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: cacatagcgtaaaaggagcaacatag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry