pFREE
(Plasmid #92050)

• Purpose: Allows inducible expression of gRNAs and Cas9 for plasmid curing.
• Depositing Lab: Morten Norholm
• Publication: Lauritsen et al Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z.

Backbone

• Vector backbone: pMAZ-SK
• Total vector size (bp): 7615
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Promoter: ptet

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AAAGTCTGGTTATAACC
• 3′ sequencing primer: TACCGGTTTATTGACTACC

Gene/Insert 2

• Gene/Insert name: gRNA array
• Species: Synthetic
• Promoter: pRhamBAD

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gccacaattcagcaaattgtgaac
• 3′ sequencing primer: GTGCCGATATCTAAGCCTATTGAG

Resource Information

• Supplemental Documents:
  • pFREE.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry