pET28a-baPrs-hdNadV
(Plasmid #91950)

• Purpose: pET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyi
• Depositing Lab: George Cătălin Marinescu
• Publication: Marinescu et al Sci Rep. 2018 Aug 16;8(1):12278. doi: 10.1038/s41598-018-30792-0.

Backbone

• Vector backbone: pET-28 a (+)
• Backbone size w/o insert (bp): 5192
• Total vector size (bp): 7706
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Putative Nicotinamide Phosphoribosyl Transferase
• Alt name: nadV
• Species: Haemophilus ducreyi, strain: ATCC 27722
• Insert Size (bp): 1490
• GenBank ID: NC_005329.1 NC_005329.1
• Entrez Gene: nadV (a.k.a. PNAD10009)
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Gene/Insert 2

• Gene/Insert name: Phosphoribosyl Pyrophosphate Synthetases
• Alt name: PRS
• Species: Bacillus amyloliquefaciens strain IAM1523
• Insert Size (bp): 1024
• Mutation: changed Leucine 135 to Isoleucine
• GenBank ID: HQ636460.1 HQ636460.1
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: NcoI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The prs gene has L135I mutation (ctc to ata) in order to eliminate the alosteric regulation of phosphoribosyl pyrophosphate synthetase (Zakataeva et all., 2011).