Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-baPrs-hdNadV
(Plasmid #91950)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91950 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-28 a (+)
  • Backbone size w/o insert (bp) 5192
  • Total vector size (bp) 7706
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Putative Nicotinamide Phosphoribosyl Transferase
  • Alt name
    nadV
  • Species
    Haemophilus ducreyi, strain: ATCC 27722
  • Insert Size (bp)
    1490
  • GenBank ID
    NC_005329.1 NC_005329.1
  • Entrez Gene
    nadV (a.k.a. PNAD10009)
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Phosphoribosyl Pyrophosphate Synthetases
  • Alt name
    PRS
  • Species
    Bacillus amyloliquefaciens strain IAM1523
  • Insert Size (bp)
    1024
  • Mutation
    changed Leucine 135 to Isoleucine
  • GenBank ID
    HQ636460.1 HQ636460.1
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site NcoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The prs gene has L135I mutation (ctc to ata) in order to eliminate the alosteric regulation of phosphoribosyl pyrophosphate synthetase (Zakataeva et all., 2011).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-baPrs-hdNadV was a gift from George Cătălin Marinescu (Addgene plasmid # 91950 ; http://n2t.net/addgene:91950 ; RRID:Addgene_91950)
  • For your References section:

    beta-nicotinamide mononucleotide (NMN) production in Escherichia coli. Marinescu GC, Popescu RG, Stoian G, Dinischiotu A. Sci Rep. 2018 Aug 16;8(1):12278. doi: 10.1038/s41598-018-30792-0. 10.1038/s41598-018-30792-0 PubMed 30115969