pAAV-U6-CB2gRNA-CBh-mCherry
(Plasmid
#91948)
-
PurposeExpression of gRNA for mouse CB2 cannabinoid receptor and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR
-
Backbone manufacturerF. Zhang Lab (Addgene #60229)
- Backbone size w/o insert (bp) 6394
- Total vector size (bp) 5956
-
Modifications to backbone1. The Cre gene in the backbone plasmid was replaced by the mCherry gene at the restriction sites AgeI and EcoRI. The mCherry DNA was PCR-amplified from the plasmid pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry (Addgene #35512). 2. The 17-bp scrambled gRNA sequence between the U6 promoter and gRNA scaffolding sequence in the control plasmid was replaced by 19-bp CB2R gRNA sequence, which targets the early part of CB2R coding sequence (26th–44th bp of 1044 bp). gRNA sequence: 5' GTGACCAACGGCTCCAACGG 3'
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-CB2gRNA-CBh-mCherry was a gift from Jimok Kim (Addgene plasmid # 91948 ; http://n2t.net/addgene:91948 ; RRID:Addgene_91948) -
For your References section:
Distinct roles of neuronal and microglial CB2 cannabinoid receptors in the mouse hippocampus. Li Y, Kim J. Neuroscience. 2017 Sep 6. pii: S0306-4522(17)30629-2. doi: 10.1016/j.neuroscience.2017.08.053. 10.1016/j.neuroscience.2017.08.053 PubMed 28888955