pRSF_6His-ZmSUMO1a-GG
(Plasmid #91929)

• Purpose: Bacterial expression of maize SUMO1a
• Depositing Lab: Richard Vierstra
• Publication: Augustine et al Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15.

Backbone

• Vector backbone: pRSFDuet-1
• Backbone size w/o insert (bp): 3829
• Total vector size (bp): 4112
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 6His-ZmSUMO1a-GG
• Species: Zea mays
• Insert Size (bp): 283
• Mutation: Truncation of ZmSUMO1a after the diGlycine motif
• Tag / Fusion Protein:
  • 6His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: GGATCTCGACGCTCTCCCT
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry