lentiCRISPR.sgKras.9
(Plasmid
#91894)
-
PurposesgRNAs targeting mouse Kras. 3rd generation lentiviral backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneaddgene 51760 lentiCRISPR
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKras sgRNA
-
gRNA/shRNA sequenceGTGGTTGGAGCTGATGGCGT
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer U6 SeqF (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bybackbone is addgene 51760 lentiCRISPR
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR.sgKras.9 was a gift from Wen Xue (Addgene plasmid # 91894 ; http://n2t.net/addgene:91894 ; RRID:Addgene_91894) -
For your References section:
Genetic disruption of oncogenic Kras sensitizes lung cancer cells to Fas receptor-mediated apoptosis. Mou H, Moore J, Malonia SK, Li Y, Ozata DM, Hough S, Song CQ, Smith JL, Fischer A, Weng Z, Green MR, Xue W. Proc Natl Acad Sci U S A. 2017 Apr 4;114(14):3648-3653. doi: 10.1073/pnas.1620861114. Epub 2017 Mar 20. 10.1073/pnas.1620861114 PubMed 28320962