Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lentiCRISPR.sgKras.9
(Plasmid #91894)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    addgene 51760 lentiCRISPR
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kras sgRNA
  • gRNA/shRNA sequence
    GTGGTTGGAGCTGATGGCGT
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer U6 SeqF
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    backbone is addgene 51760 lentiCRISPR

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR.sgKras.9 was a gift from Wen Xue (Addgene plasmid # 91894 ; http://n2t.net/addgene:91894 ; RRID:Addgene_91894)
  • For your References section:

    Genetic disruption of oncogenic Kras sensitizes lung cancer cells to Fas receptor-mediated apoptosis. Mou H, Moore J, Malonia SK, Li Y, Ozata DM, Hough S, Song CQ, Smith JL, Fischer A, Weng Z, Green MR, Xue W. Proc Natl Acad Sci U S A. 2017 Apr 4;114(14):3648-3653. doi: 10.1073/pnas.1620861114. Epub 2017 Mar 20. 10.1073/pnas.1620861114 PubMed 28320962