AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFP
(Plasmid
#91883)
-
PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
-
Backbone manufacturerFeng Zhang Lab (Addgene #48138)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting Gfi1
-
gRNA/shRNA sequenceGCTATCGGCAGTGCAGCGCGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneGfi1 (a.k.a. Gfi-1, Pal-1, Pal1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector also contains FLAG-tagged SpCas9-2A-EGFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFP was a gift from Martine Roussel (Addgene plasmid # 91883 ; http://n2t.net/addgene:91883 ; RRID:Addgene_91883) -
For your References section:
Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Vo BT, Li C, Morgan MA, Theurillat I, Finkelstein D, Wright S, Hyle J, Smith SM, Fan Y, Wang YD, Wu G, Orr BA, Northcott PA, Shilatifard A, Sherr CJ, Roussel MF. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073. 10.1016/j.celrep.2017.02.073 PubMed 28329683
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/91/91883/91883-map_kZHB9dpENc4z.pdf.940x940_q85_autocrop.png)