Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSpCas9(BB)-2A-miRFP670
(Plasmid #91854)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91854 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX459
  • Backbone size w/o insert (bp) 2522
  • Total vector size (bp) 8866
  • Modifications to backbone
    Removal of F1 promoter. Exchange of 2A-puro with 2A-miRFP670.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    hSpCas9-2A-miRFP670
  • Alt name
    Cas9
  • Alt name
    iRFP
  • Species
    Synthetic
  • Insert Size (bp)
    6300
  • GenBank ID
    hSpCas9-2A-miRFP670
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • 2A-miRFP670 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTTATGGCGAGGCGGCGG
  • 3′ sequencing primer CATCACTAGGGGTTCCTGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BB-guide RNA
  • Alt name
    U6-BB-gRNA
  • Species
    Synthetic
  • Insert Size (bp)
    300
  • GenBank ID
    U6- BbsI-gRNA
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GACAGGTATCCGGTAAGCGG
  • 3′ sequencing primer TGGAAAGTCCCTATTGGCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is an altered version of the Zhang Lab's Addgene Plasmid #62988 Cas9-2A-Puro. The miRFP670 came from Verkhusha Lab's Addgene Plasmid #79987. The 2A sequence from the original plasmid was kept. Also, the F1 sequence was deleted.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-miRFP670 was a gift from Ralf Kuehn (Addgene plasmid # 91854 ; http://n2t.net/addgene:91854 ; RRID:Addgene_91854)