pDD121
(Plasmid #91833)

• Purpose: Cas9 expression in C. elegans
• Depositing Lab: Bob Goldstein
• Publication: Dickinson et al MicroPubl Biol. 2018 May 1;2018:10.17912/W2KT0N. doi: 10.17912/W2KT0N.

Backbone

• Vector backbone: pCFJ601
• Backbone manufacturer: Erik Jorgensen lab (Addgene #24874)
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Species: Synthetic
• Insert Size (bp): 4323
• Mutation: Codon optimized and with synthetic introns for C. elegans

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAGTTGGGAAACACTTTGCT
• 3′ sequencing primer: gcttgaaaggattttgcatttatc

Resource Information

• Supplemental Documents:
  • Cas9 only pDD121.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Same Cas9 expression cassette present in the widely-used pDD162, but does not have an sgRNA expression cassette.