pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
(Plasmid
#91802)
-
PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be used
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRII-TOPO
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 8719
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCoral Green Fluorescent Protein (cGFP)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2 was a gift from Jeremy Wilusz (Addgene plasmid # 91802 ; http://n2t.net/addgene:91802 ; RRID:Addgene_91802) -
For your References section:
Use of circular RNAs as markers of readthrough transcription to identify factors regulating cleavage/polyadenylation events. Liang D, Tatomer DC, Wilusz JE. Methods. 2021 Apr 18. pii: S1046-2023(21)00104-3. doi: 10.1016/j.ymeth.2021.04.012. 10.1016/j.ymeth.2021.04.012 PubMed 33882363