Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
(Plasmid #91802)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91802 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCRII-TOPO
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 8719
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Coral Green Fluorescent Protein (cGFP)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2 was a gift from Jeremy Wilusz (Addgene plasmid # 91802 ; http://n2t.net/addgene:91802 ; RRID:Addgene_91802)
  • For your References section:

    Use of circular RNAs as markers of readthrough transcription to identify factors regulating cleavage/polyadenylation events. Liang D, Tatomer DC, Wilusz JE. Methods. 2021 Apr 18. pii: S1046-2023(21)00104-3. doi: 10.1016/j.ymeth.2021.04.012. 10.1016/j.ymeth.2021.04.012 PubMed 33882363