Hy_pMT dati
(Plasmid
#91800)
-
PurposeExpresses the Drosophila dati circular RNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHy_pMT
- Total vector size (bp) 8630
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedati
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1487
-
Entrez Genedati (a.k.a. Dmel_CG2052, CG10204, CG2052, DmLin29, Dmel\CG2052, Lin29)
- Promoter Metallothionein Promoter (pMT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMT dati was a gift from Jeremy Wilusz (Addgene plasmid # 91800 ; http://n2t.net/addgene:91800 ; RRID:Addgene_91800) -
For your References section:
The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Liang D, Tatomer DC, Luo Z, Wu H, Yang L, Chen LL, Cherry S, Wilusz JE. Mol Cell. 2017 Nov 9. pii: S1097-2765(17)30835-3. doi: 10.1016/j.molcel.2017.10.034. 10.1016/j.molcel.2017.10.034 PubMed 29174924