Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Hy_pMT dati
(Plasmid #91800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91800 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Hy_pMT
  • Total vector size (bp) 8630
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dati
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1487
  • Entrez Gene
    dati (a.k.a. Dmel_CG2052, CG10204, CG2052, DmLin29, Dmel\CG2052, Lin29)
  • Promoter Metallothionein Promoter (pMT)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACTCGAATTTGGAGCCGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hy_pMT dati was a gift from Jeremy Wilusz (Addgene plasmid # 91800 ; http://n2t.net/addgene:91800 ; RRID:Addgene_91800)
  • For your References section:

    The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Liang D, Tatomer DC, Luo Z, Wu H, Yang L, Chen LL, Cherry S, Wilusz JE. Mol Cell. 2017 Nov 9. pii: S1097-2765(17)30835-3. doi: 10.1016/j.molcel.2017.10.034. 10.1016/j.molcel.2017.10.034 PubMed 29174924