Hy_pMT Laccase2 Exons 1-3
(Plasmid #91799)

• Purpose: Drosophila laccase2 minigene plasmid that expresses both a linear RNA and a circular RNA
• Depositing Lab: Jeremy Wilusz
• Publication: Liang et al Mol Cell. 2017 Nov 9. pii: S1097-2765(17)30835-3. doi: 10.1016/j.molcel.2017.10.034.

Backbone

• Vector backbone: Hy_pMT
• Total vector size (bp): 10612
• Vector type: Insect Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Laccase2
• Species: D. melanogaster (fly)
• Insert Size (bp): 3469
• Entrez Gene: stw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
• Promoter: Metallothionein Promoter (pMT)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CACTCGAATTTGGAGCCGGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry