Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLEX_305-N-dTAG
(Plasmid #91797)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91797 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 91797-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

Backbone

  • Vector backbone
    pLEX_305
  • Backbone manufacturer
    David Root Lab (addgene #41390)
  • Backbone size (bp) 9621
  • Modifications to backbone
    FKBP F36V tag (dTAG) added to the 5' end of the gateway cassette.
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter hPGK
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • FKBP F36V (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB resistant bacteria. 30C for liquid culture and for plates.
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGTTCCGCATTCTGCAAGCCTC
  • 3′ sequencing primer ACAAAGGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for Cloning Grade DNA (Catalog # 91797-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX_305-N-dTAG was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91797 ; http://n2t.net/addgene:91797 ; RRID:Addgene_91797)
  • For your References section:

    The dTAG system for immediate and target-specific protein degradation. Nabet B, Roberts JM, Buckley DL, Paulk J, Dastjerdi S, Yang A, Leggett AL, Erb MA, Lawlor MA, Souza A, Scott TG, Vittori S, Perry JA, Qi J, Winter GE, Wong KK, Gray NS, Bradner JE. Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26. 10.1038/s41589-018-0021-8 PubMed 29581585