pCRIS-PITChv2-dTAG-BSD (BRD4)
(Plasmid #91795)

• Purpose: PITCh dTAG donor vector for FKBP_F36V-2xHA-P2A-BSD knock-in into the C-terminus of the human BRD4 locus.
• Depositing Labs: James Bradner, Behnam Nabet
• Publication: Nabet et al Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26.

Backbone

• Vector backbone: pCRIS-PITChv2 (addgene #63672)
• Backbone manufacturer: Takashi Yamamoto lab
• Backbone size w/o insert (bp): 4579
• Total vector size (bp): 5537
• Modifications to backbone: A C-terminal dTAG cassette for endogenous protein degradation replaced the EGFP cassette in the original pCRIS-PITChv2 plasmid (addgene #63672)
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FKBP_F36V-2xHA-P2A-BSD
• Species: Synthetic
• Mutation: Phenylalanine 36 to valine in FKBP12
• Promoter: Promotorless

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcgcccttaattgtgagcgga
• 3′ sequencing primer: gaaaggacagtgggagtggca

Resource Information

• Supplemental Documents:
  • pCRIS-PITChv2-dTAG-BSD (BRD4).gbk
  • dTAGprotocol
• A portion of this plasmid was derived from a plasmid made by: Takashi Yamamoto lab (addgene #63672)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See:
Sakuma, T., Nakade, S., Sakane, Y., Suzuki, K.-I. & Yamamoto, T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc 11, 118–133 (2016).
for the original backbone and general cloning protocol.