Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRIS-PITChv2-dTAG-BSD (BRD4)
(Plasmid #91795)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91795 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCRIS-PITChv2 (addgene #63672)
  • Backbone manufacturer
    Takashi Yamamoto lab
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 5537
  • Modifications to backbone
    A C-terminal dTAG cassette for endogenous protein degradation replaced the EGFP cassette in the original pCRIS-PITChv2 plasmid (addgene #63672)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP_F36V-2xHA-P2A-BSD
  • Species
    Synthetic
  • Mutation
    Phenylalanine 36 to valine in FKBP12
  • Promoter Promotorless

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcgcccttaattgtgagcgga
  • 3′ sequencing primer gaaaggacagtgggagtggca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See:
Sakuma, T., Nakade, S., Sakane, Y., Suzuki, K.-I. & Yamamoto, T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc 11, 118–133 (2016).
for the original backbone and general cloning protocol.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRIS-PITChv2-dTAG-BSD (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91795 ; http://n2t.net/addgene:91795 ; RRID:Addgene_91795)
  • For your References section:

    The dTAG system for immediate and target-specific protein degradation. Nabet B, Roberts JM, Buckley DL, Paulk J, Dastjerdi S, Yang A, Leggett AL, Erb MA, Lawlor MA, Souza A, Scott TG, Vittori S, Perry JA, Qi J, Winter GE, Wong KK, Gray NS, Bradner JE. Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26. 10.1038/s41589-018-0021-8 PubMed 29581585