pX330A-nBRD4/PITCh
(Plasmid #91794)

• Purpose: PITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4
• Depositing Labs: James Bradner, Behnam Nabet
• Publication: Nabet et al Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26.

Backbone

• Vector backbone: pX330A
• Backbone size w/o insert (bp): 4850
• Total vector size (bp): 8951
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpCas9
• gRNA/shRNA sequence: ATGTCTGCGGAGAGCGGCCC (BRD4), gcatcgtacgcgtacgtgtt (PITCH)
• Species: Synthetic
• Promoter: chicken β-actin promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: gccttttgctggccttttgctc
• 3′ sequencing primer: cgggccatttaccgtaagttatgtaacg

Resource Information

• Supplemental Documents:
  • pX330A-nBRD4 PITCh.gbk
  • dTAGprotocol

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See:
Sakuma, T., Nakade, S., Sakane, Y., Suzuki, K.-I. & Yamamoto, T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc 11, 118–133 (2016).
for the original backbone and general cloning protocol.