pHIV-H2B-eGFP
(Plasmid #91776)

• Purpose: Expresses H2B protein tagged with eGFP
• Depositing Lab: Maria Pia Cosma
• Publication: Sottile et al Sci Rep. 2016 Nov 9;6:36863. doi: 10.1038/srep36863.

Backbone

• Vector backbone: HIV-H2B-mRFP
• Backbone size w/o insert (bp): 8054
• Total vector size (bp): 8091
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human Histone H2B / eGFP
• Alt name: HIST1H2BJ
• Species: H. sapiens (human)
• Insert Size (bp): 1135
• Entrez Gene: H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
• Promoter: EF1a
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: atcatgaattcgtttgtgaacgacattttcgagcg
• 3′ sequencing primer: atcgatGTCGCGGCCGCTTTACTTGTACA

Resource Information

• Supplemental Documents:
  • pHIV-H2B-eGFP.gbk
• A portion of this plasmid was derived from a plasmid made by: We used the H2B-GFP plasmid from Geoff Wahl (Addgene plasmid # 11680) as donor vector
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The HIV-H2BeGFP plasmid was cloned by replacing mRFP in HIV-H2B-mRFP (Bryan Welm & Zena Werb Addgene plasmid # 18982 ) with H2BeGFP from H2B-GFP plasmid (Geoff Wahl Addgene plasmid # 11680) to generate a bicistronic lentiviral vector.