-
PurposeMonocot Target-AID vector expressing rice-optimized nCas9-PmCDA1 with sgRNA targeting OsAls
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepZDgRNA_Cas9ver.2 (D10A)_HPT
- Backbone size w/o insert (bp) 17773
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9
-
SpeciesStreptococcus pyogenes
-
MutationD10A for nickase Cas9
- Promoter 2x35S
-
Tag
/ Fusion Protein
- PmCDA1 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaagttcatttcatttggagag
- 3′ sequencing primer ccatttgcattttgatgtccg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMonAID_nCas9-PmCDA_Hyg_ALS was a gift from Akihiko Kondo (Addgene plasmid # 91693 ; http://n2t.net/addgene:91693 ; RRID:Addgene_91693) -
For your References section:
Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Shimatani Z, Kashojiya S, Takayama M, Terada R, Arazoe T, Ishii H, Teramura H, Yamamoto T, Komatsu H, Miura K, Ezura H, Nishida K, Ariizumi T, Kondo A. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833. 10.1038/nbt.3833 PubMed 28346401
Map uploaded by the depositor.
