pPN106
(Plasmid
#91635)
-
PurposeExpress sgRNA targeting human KDM4A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19-U6 promoter
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDM4A
-
Alt nameNM_014663.2
-
gRNA/shRNA sequenceTTTCGGAACTCTTCCATAGT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)21
-
Entrez GeneKDM4A (a.k.a. JHDM3A, JMJD2, JMJD2A, TDRD14A)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer M13F (-21) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPN106 was a gift from Lindy Barrett (Addgene plasmid # 91635 ; http://n2t.net/addgene:91635 ; RRID:Addgene_91635) -
For your References section:
A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Hazelbaker DZ, Beccard A, Bara AM, Dabkowski N, Messana A, Mazzucato P, Lam D, Manning D, Eggan K, Barrett LE. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006. 10.1016/j.stemcr.2017.09.006 PubMed 29020615