Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPN261
(Plasmid #91582)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91582 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19-U6 promoter
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CLU
  • Alt name
    NR_045494.1
  • gRNA/shRNA sequence
    AATTCAAAATGCTGTCAACG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    CLU (a.k.a. AAG4, APO-J, APOJ, CLI, CLU1, CLU2, KUB1, NA1/NA2, SGP-2, SGP2, SP-40, TRPM-2, TRPM2)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer M13F (-21)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPN261 was a gift from Lindy Barrett (Addgene plasmid # 91582 ; http://n2t.net/addgene:91582 ; RRID:Addgene_91582)
  • For your References section:

    A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Hazelbaker DZ, Beccard A, Bara AM, Dabkowski N, Messana A, Mazzucato P, Lam D, Manning D, Eggan K, Barrett LE. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006. 10.1016/j.stemcr.2017.09.006 PubMed 29020615