pSAM_AraC
(Plasmid #91569)

• Purpose: Mariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Arabinose promoter expresses transposase. Ampicillin resistance on backbone.
• Depositing Lab: Harry Mobley
• Publication: Armbruster et al PLoS Pathog. 2017 Jun 14;13(6):e1006434. doi: 10.1371/journal.ppat.1006434.

Backbone

• Vector backbone: pSAM_Ec
• Backbone manufacturer: N/A
• Backbone size w/o insert (bp): 4559
• Total vector size (bp): 5906
• Modifications to backbone: Put arabinose inducible promoter before transposase
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): S17-1λpir
• Growth instructions: Add 10 mM glucose to repress transposase. S17-1λpir may be EndA+ so extra purification steps may be necessary during miniprep.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: AraC/PBAD
• Species: E. coli
• Insert Size (bp): 1200

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: NcoI (unknown if destroyed)
• 5′ sequencing primer: TTATGACAACTTGACGGCTA
• 3′ sequencing primer: ATGCCATAGCATTTTTATCC

Resource Information

• Supplemental Documents:
  • pSAM_AraC seqbuilder file
  • pSAM_AraC.gbk
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mariner himar1C9 transposase driven by an arabinose promoter on an R6K gamma suicide plasmid. The transposon allows identification of fitness factors by Illumina sequencing. This transposon will randomly insert a kanamycin resistance cassette into genomic TA sites. Ampicillin resistance is contained on the plasmid backbone.

For further background, see:
Goodman, Andrew L., Meng Wu, and Jeffrey I. Gordon. “Identifying Microbial Fitness Determinants by Insertion Sequencing (INSeq) Using Genome-Wide Transposon Mutant Libraries.” Nature Protocols 6.12 (2011): 1969–1980. PMC. Web. 11 Apr. 2017.

Wiles, Travis J. et al. “Combining Quantitative Genetic Footprinting and Trait Enrichment Analysis to Identify Fitness Determinants of a Bacterial Pathogen.” Ed. Danielle A. Garsin. PLoS Genetics 9.8 (2013): e1003716. PMC. Web. 11 Apr. 2017.