pCRISPRi_Mxi1_yl
(Plasmid #91248)

• Purpose: CRISPR-dCas9-Mxi1 vector for Yarrowia lipolytica, expressing dCas9-Mxi1 and AvrII site for sgRNA insertion
• Depositing Lab: Ian Wheeldon
• Publication: Schwartz et al Biotechnol Bioeng. 2017 Aug 19. doi: 10.1002/bit.26404.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2623
• Total vector size (bp): 11975
• Vector type: Yeast Expression, CRISPR, Synthetic Biology
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Codon optimized dCas9-Mxi1
• Species: Synthetic
• Insert Size (bp): 4311
• Promoter: UAS1B8-TEF(136)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BssHII (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GTAAAACGACGGCCAGT
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Gene/Insert 2

• Gene/Insert name: sgRNA expression cassette
• Species: Synthetic
• Insert Size (bp): 525
• Promoter: SCR1'-tRNA

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCATTTATCAGGGTTATTGTCTCATGAG
• 3′ sequencing primer: CACGAGCAGCTTGCCTATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry