pKD233.7-3
(Plasmid #90955)

• Purpose: Expresses S. baltica TtrR under the PltetO-1 promoter, sfGFP under PttrB185-269, and mCherry constitutively
• Depositing Lab: Jeffrey Tabor
• Publication: Daeffler et al Mol Syst Biol. 2017 Apr 3;13(4):923. doi: 10.15252/msb.20167416.

Backbone

• Vector backbone: ColE1
• Total vector size (bp): 5437
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Tetrathionate response regulator
• Alt name: TtrR
• Species: Shewanella baltica OS195
• Insert Size (bp): 621
• GenBank ID: ABX51018
• Promoter: PltetO-1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTCTAAGAAACCATTATTATCATGACATTAAC

Gene/Insert 2

• Gene/Insert name: Superfolder GFP
• Alt name: sfGFP
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: PttrB185-269

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCGTTCTGGATAATGTTTTTTGCG

Gene/Insert 3

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: Bba_J23114

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTTCCTTAGCTCCTGAAAATCTC

Resource Information

• Supplemental Documents:
  • pkd233-7-3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's sequencing results found A82V and G196S mutations in mCherry and a K140M mutation in sfGFP. The depositing lab confirmed that mCherry is functional as a constitutive marker, and that sfGFP fluorescence increases upon sensor activation.