pKD184
(Plasmid #90953)

• Purpose: Expresses ThsR under the PltetO-1 promoter, sfGFP under PphsA, and mCherry constitutively
• Depositing Lab: Jeffrey Tabor
• Publication: Daeffler et al Mol Syst Biol. 2017 Apr 3;13(4):923. doi: 10.15252/msb.20167416.

Backbone

• Vector backbone: ColE1
• Total vector size (bp): 5684
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Thiosulfate response regulator
• Alt name: ThsR
• Species: Shewanella halifaxensis HAW-EB4
• Insert Size (bp): 612
• GenBank ID: ABZ77676
• Promoter: PltetO-1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTCTAAGAAACCATTATTATCATGACATTAAC

Gene/Insert 2

• Gene/Insert name: Superfolder GFP
• Alt name: sfGFP
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: PphsA

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCGTTCTGGATAATGTTTTTTGCG

Gene/Insert 3

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: Bba_J23114

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTTCCTTAGCTCCTGAAAATCTC

Resource Information

• Supplemental Documents:
  • pkd184.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry