Skip to main content
Addgene

pBABE-zeo small T H42Q
(Plasmid #9065)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 9065 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBABE-zeo
  • Backbone size w/o insert (bp) 4800
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SV40 small T Antigen
  • Species
    simian virus
  • Insert Size (bp)
    520
  • Entrez Gene
    SV40gp7 (a.k.a. SV40gp7)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pBABE 5'
  • 3′ sequencing primer pBABE 3'
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A retrovirus encoding the SV40 small t (ST) oncoprotein was constructed by amplifying the ST sequences by PCR using the vector pVU- (30) and the oligonucleotides B5ST (5' GGCGGATCCGCCACCATGGATAAAGTTTT 3') and E3ST (5'AGGCGAATTCTTAGAGCTTTAAATCTCTG 3'). The resulting fragment was sequenced and introduced into pMIG (pMIG-ST) (81) and pBABE-zeo. H42Q mutant.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABE-zeo small T H42Q was a gift from Bob Weinberg (Addgene plasmid # 9065 ; http://n2t.net/addgene:9065 ; RRID:Addgene_9065)

  • For your References section:

    Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Hahn WC, Dessain SK, Brooks MW, King JE, Elenbaas B, Sabatini DM, DeCaprio JA, Weinberg RA. Mol Cell Biol 2002 Apr;22(7):2111-23. 10.1128/MCB.22.7.2111-2123.2002 PubMed 11884599
Related items:
Commonly requested with: