pMIG small T H42Q
(Plasmid #9062)

• Depositing Lab: Bob Weinberg
• Publication: Hahn et al Mol Cell Biol 2002 Apr;22(7):2111-23.

Backbone

• Vector backbone: pMIG
• Backbone size w/o insert (bp): 7000
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SV40 small T Antigen H42Q
• Alt name: SV40 small T Antigen
• Species: simian virus
• Insert Size (bp): 520
• Mutation: H42Q. Renders J domain nonfunctional.
• Entrez Gene: SV40gp7 (a.k.a. SV40gp7)
• Tag / Fusion Protein:
  • IRES GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pLXSN 5'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A retrovirus encoding the SV40 small t (ST) oncoprotein was constructed by amplifying the ST sequences by PCR using the oligonucleotides B5ST (5' GGCGGATCCGCCACCATGGATAAAGTTTT 3') and E3ST (5'AGGCGAATTCTTAGAGCTTTAAATCTCTG 3'). The resulting fragment was sequenced and introduced into pMIG. H42Q mutant.