pMIG small T
(Plasmid #9059)

• Depositing Lab: Bob Weinberg
• Publication: Hahn et al Mol Cell Biol 2002 Apr;22(7):2111-23.

Backbone

• Vector backbone: pMIG
• Backbone size w/o insert (bp): 7000
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SV40 small T Antigen
• Species: simian virus
• Insert Size (bp): 520
• Entrez Gene: SV40gp7 (a.k.a. SV40gp7)
• Tag / Fusion Protein:
  • IRES GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pLXSN 5'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A retrovirus encoding the SV40 small t (ST) oncoprotein was constructed by amplifying the ST sequences by PCR using the oligonucleotides B5ST (5' GGCGGATCCGCCACCATGGATAAAGTTTT 3') and E3ST (5'AGGCGAATTCTTAGAGCTTTAAATCTCTG 3'). The resulting fragment was sequenced and introduced into pMIG.