pLXSN p110 CUX1
(Plasmid #90471)

• Purpose: Retroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectively
• Depositing Lab: Alain Nepveu
• Publication: Kedinger et al J Biol Chem. 2009 Oct 2;284(40):27701-11. doi: 10.1074/jbc.M109.031849. Epub 2009 Jul 27.

Backbone

• Vector backbone: pLXSN
• Backbone manufacturer: Miller, A.D.
• Backbone size w/o insert (bp): 5875
• Total vector size (bp): 8240
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CUX1 (amino acids 747-1505)
• Alt name: CCAAT-displacement protein
• Alt name: Cut-like 1
• Species: H. sapiens (human)
• Insert Size (bp): 2368
• GenBank ID: M74099
• Entrez Gene: CUX1 (a.k.a. CASP, CDP, CDP/Cut, CDP1, COY1, CUTL1, CUX, Clox, Cux/CDP, GDDI, GOLIM6, Nbla10317, p100, p110, p200, p75)
• Promoter: Moloney murine leukemia virus long terminal repeat
• Tags / Fusion Proteins:
  • Myc (N terminal on insert)
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: GTCTCTCCCCCTTGAACC
• 3′ sequencing primer: CCACACCCTAACTGACACAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry