Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRIPZ-DoxOn-shCUX1-5150
(Plasmid #90469)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90469 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRIPZ
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TGCTGTTGACAGTGAGCGTCAGAGCGATAATACACTATTATAGTGAAGCC
  • gRNA/shRNA sequence
    shRNA 5150
  • GenBank ID
    Hs CUX1 M74099

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ-DoxOn-shCUX1-5150 was a gift from Alain Nepveu (Addgene plasmid # 90469 ; http://n2t.net/addgene:90469 ; RRID:Addgene_90469)
  • For your References section:

    RAS transformation requires CUX1-dependent repair of oxidative DNA damage. Ramdzan ZM, Vadnais C, Pal R, Vandal G, Cadieux C, Leduy L, Davoudi S, Hulea L, Yao L, Karnezis AN, Paquet M, Dankort D, Nepveu A. PLoS Biol. 2014 Mar 11;12(3):e1001807. doi: 10.1371/journal.pbio.1001807. eCollection 2014 Mar. PBIOLOGY-D-13-03283 [pii] PubMed 24618719