-
PurposeA YFP-based chloride sensor with enhanced chloride sensitivity, photostability and reduced pH interference. The sequence of mClY is EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEYFP N1
- Backbone size w/o insert (bp) 4013
- Total vector size (bp) 4733
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemClY-N1
-
Alt namemonomeric Cl-YFP
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)720
-
MutationEYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGAGGTTTTTTAAAGCAAGTA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mClY-N1 was a gift from Joseph Santos-Sacchi (Addgene plasmid # 90457 ; http://n2t.net/addgene:90457 ; RRID:Addgene_90457) -
For your References section:
A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride movement by gerbil prestin (SLC26a5). Zhong S, Navaratnam D, Santos-Sacchi J. PLoS One. 2014 Jun 5;9(6):e99095. doi: 10.1371/journal.pone.0099095. eCollection 2014. PONE-D-13-54352 [pii] PubMed 24901231