mClY-N1
(Plasmid #90457)

• Purpose: A YFP-based chloride sensor with enhanced chloride sensitivity, photostability and reduced pH interference. The sequence of mClY is EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.
• Depositing Lab: Joseph Santos-Sacchi
• Publication: Zhong et al PLoS One. 2014 Jun 5;9(6):e99095. doi: 10.1371/journal.pone.0099095. eCollection 2014.

Backbone

• Vector backbone: pEYFP N1
• Backbone size w/o insert (bp): 4013
• Total vector size (bp): 4733
• Modifications to backbone: None
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mClY-N1
• Alt name: monomeric Cl-YFP
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): 720
• Mutation: EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GGAGGTTTTTTAAAGCAAGTA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry