Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mClY-N1
(Plasmid #90457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEYFP N1
  • Backbone size w/o insert (bp) 4013
  • Total vector size (bp) 4733
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mClY-N1
  • Alt name
    monomeric Cl-YFP
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
  • Insert Size (bp)
    720
  • Mutation
    EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGAGGTTTTTTAAAGCAAGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mClY-N1 was a gift from Joseph Santos-Sacchi (Addgene plasmid # 90457 ; http://n2t.net/addgene:90457 ; RRID:Addgene_90457)
  • For your References section:

    A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride movement by gerbil prestin (SLC26a5). Zhong S, Navaratnam D, Santos-Sacchi J. PLoS One. 2014 Jun 5;9(6):e99095. doi: 10.1371/journal.pone.0099095. eCollection 2014. PONE-D-13-54352 [pii] PubMed 24901231