pL452(hygro)-Sf3b1-K700K
(Plasmid #90426)

• Purpose: selectable HDR vector to introduce silent mutation (position 700) in mus Sf3b1 gene (for use with pL452-Sf3b1-K700E and sgSf3b1(T1) gRNA vectors enabling generation of hemizygous K700E mutation)
• Depositing Lab: Alex Minella
• Publication: Gupta et al Nucleic Acids Res. 2018 Nov 20. pii: 5193340. doi: 10.1093/nar/gky1161.

Backbone

• Vector backbone: pL452
• Backbone size w/o insert (bp): 4823
• Modifications to backbone: Neomycin resistance cassette in original pL452 vector substituted with hygromycin resistance cassette, enabling dual selection
• Vector type: homology-directed repair vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sf3b1 - left and right homology arms
• Species: M. musculus (mouse)
• Insert Size (bp): 800
• Entrez Gene: Sf3b1 (a.k.a. 155kDa, 2810001M05Rik, Prp10, SAP155, SF3b155, TA-8, Targ4)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal1 (left arm); BamH1 (right arm) (not destroyed)
• 3′ cloning site: EcoR1 (left arm); Not1 (right arm) (not destroyed)
• 5′ sequencing primer: TCACTAAAGGGAACAAAAGC (left arm); TCGACTAGAGCTTGCGGA (right arm)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry