pM9_NR_HD
(Plasmid #90415)

• Purpose: TALEN Backbone for Phaeodactylum tricornutum_ NR promotor_HD
• Depositing Lab: Peter Kroth
• Publication: Serif et al Algal Research Volume 23, April 2017, Pages 186–195

Backbone

• Vector backbone: pPha-NR
• Backbone manufacturer: GenBank_NCBI: JN180663
• Backbone size w/o insert (bp): 3860
• Total vector size (bp): 7011
• Modifications to backbone: Site directed mutagenesis of BsaI Restriction sites, to delete it. Zeocin resistance gene (Sh ble) from the pPha-NR vector was exchanged with the Nourseothricin resistance gene (nat).
• Vector type: Phaeodactylum tricornutum
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TALEN Backbone
• Species: Phaeodactylum tricornutum

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: CCAGTTGCTGAAGATCGCGAAGC
• 3′ sequencing primer: TGCCACTCGATGTGATGTCCTC

Resource Information

• Supplemental Documents:
  • pM9_NR_HD_gb.txt
• A portion of this plasmid was derived from a plasmid made by: Tale Toolbox Feng Zhang, from Addgene. kit #1000000019
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

N.E. Sanjana, L. Cong, Y. Zhou, M.M. Cunniff, G. Feng, F. Zhang
A transcription activator-like effector toolbox for genome engineering
Nat. Protoc., 7 (2012), pp. 171–192