pLminP_Luc2P_RE1
(Plasmid #90335)

• Purpose: NFkB - p50/p65 pathway gene reporter
• Depositing Lab: Ramnik Xavier
• Publication: O'Connell et al Cell Syst. 2016 May 25;2(5):323-34. doi: 10.1016/j.cels.2016.04.011. Epub 2016 May 19.

Backbone

• Vector backbone: pLenti7.3
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 7251
• Total vector size (bp): 9293
• Vector type: Lentiviral
• Selectable markers: eGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Alt name: Luc2P
• Species: P. pyralis
• Insert Size (bp): 1776
• GenBank ID:
• Promoter: NFKB

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGTACAGTGCAGGGGAAAGA

Resource Information

• Supplemental Documents:
  • pLminPluc2P_RE1_p50_RELA.gb
• A portion of this plasmid was derived from a plasmid made by: pGL4.29 reporter vector (Promega)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry