pSH1
(Plasmid #90295)

• Purpose: Expresses the fat-7 gene in C. elegans intestine
• Depositing Lab: Anne Brunet
• Publication: Han et al Nature. 2017 Apr 13;544(7649):185-190. doi: 10.1038/nature21686. Epub 2017 Apr 5.

Backbone

• Vector backbone: p4P1R
• Backbone manufacturer: Frederick Mann, Kim Lab
• Backbone size w/o insert (bp): 4463
• Total vector size (bp): 6239
• Modifications to backbone: This p4P1R vector already contains a 2kb insert of ges-1 promoter.
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fat-7
• Species: C. elegans (nematode)
• Insert Size (bp): 1776
• Entrez Gene: fat-7 (a.k.a. CELE_F10D2.9)
• Promoter: ges-1
• Tag / Fusion Protein:
  • No

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGACGGTAAAAACTCGCGC
• 3′ sequencing primer: TTACATGATCGATTTTTTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry