Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

1068 pGL3 FasL promoter (no SV40 prom)
(Plasmid #9029)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 9029 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3 promoter
  • Backbone size w/o insert (bp) 4810
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fas ligand promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    100
  • Mutation
    Removed the SV40 promoter from pGL3
  • Entrez Gene
    FASLG (a.k.a. ALPS1B, APT1LG1, APTL, CD178, CD95-L, CD95L, FASL, TNFSF6, TNLG1A)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer RVprimer3
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Oligonucleotides 5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTATTTAAATAAATAAGTAAATAAATAAAC-3' and 5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were phosphorylated, annealed, and ligated to pGL3-promoter restricted with BglII and NheI to give pGL3-promoter-FasL. This plasmid was subsequently restricted with BglII and HindIII, blunted, and ligated to remove the simian virus 40

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1068 pGL3 FasL promoter (no SV40 prom) was a gift from William Sellers (Addgene plasmid # 9029 ; http://n2t.net/addgene:9029 ; RRID:Addgene_9029)
  • For your References section:

    Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers WR. Mol Cell Biol. 2000 Dec . 20(23):8969-82. 10.1128/MCB.20.23.8969-8982.2000 PubMed 11073996