1037 pGL3 FasL promoter
(Plasmid #9028)

• Depositing Lab: William Sellers
• Publication: Nakamura et al Mol Cell Biol. 2000 Dec . 20(23):8969-82.

Backbone

• Vector backbone: pGL3 promoter
• Backbone size w/o insert (bp): 5010
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fas ligand promoter
• Species: H. sapiens (human)
• Insert Size (bp): 100
• Entrez Gene: FASLG (a.k.a. ALPS1B, APT1LG1, APTL, CD178, CD95-L, CD95L, FASL, TNFSF6, TNLG1A)
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: RVprimer3

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Oligonucleotides 5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTATTTAAATAAATAAGTAAATAAATAAAC-3' and 5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were phosphorylated, annealed, and ligated to pGL3-promoter restricted with BglII and NheI to give pGL3-promoter-FasL.