pCAS_gpyrG2
(Plasmid
#90277)
-
Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBB3_AMA_2.8_pUC-ORI_L_AC_hph
- Backbone size w/o insert (bp) 5997
- Total vector size (bp) 14715
-
Vector typeBacterial Expression ; A. niger
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA (pyrg2)
-
gRNA/shRNA sequenceGTAGGTCAATTGCGACTTGG
-
SpeciesA. niger
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer -
- 3′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAS_gpyrG2 was a gift from Michael Sauer (Addgene plasmid # 90277 ; http://n2t.net/addgene:90277 ; RRID:Addgene_90277) -
For your References section:
An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066