BB2_L_12_syn_A_E
(Plasmid
#90271)
-
Purpose(Empty Backbone) BB2 Linker containing between FS1 and FS2 the BB3 linker with FSA and FSE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBB2_L_12_syn_A_E
- Backbone size (bp) 3147
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATTAATGCAGCTGGCAC
- 3′ sequencing primer GGTTATTGTCTCATGAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BB2_L_12_syn_A_E was a gift from Michael Sauer (Addgene plasmid # 90271 ; http://n2t.net/addgene:90271 ; RRID:Addgene_90271) -
For your References section:
An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066