pFlare9A-Dup34
(Plasmid
#90267)
-
Purpose(Empty Backbone) Minigene reporter for alternative splicing analysis
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepflare9A-Dup34
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- 5′ sequencing primer CAGATCTACCATTGGTGCACCTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFlare9A-Dup34 was a gift from Douglas Black (Addgene plasmid # 90267 ; http://n2t.net/addgene:90267 ; RRID:Addgene_90267) -
For your References section:
A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Stoilov P, Lin CH, Damoiseaux R, Nikolic J, Black DL. Proc Natl Acad Sci U S A. 2008 Aug 12;105(32):11218-23. doi: 10.1073/pnas.0801661105. Epub 2008 Aug 4. 10.1073/pnas.0801661105 PubMed 18678901
Map uploaded by the depositor.
