pLentiPGK Puro DEST JNKKTR EE Clover
(Plasmid #90239)

• Purpose: Lentiviral vector to express JNK KTR EE (mutant) mClover under PGK promoter (With Puromycin Resistance)
• Depositing Lab: Markus Covert
• Publication: Kudo et al Nat Protoc. 2018 Jan;13(1):155-169. doi: 10.1038/nprot.2017.128. Epub 2017 Dec 21.

Backbone

• Vector backbone: pLENTI PGK Puro DEST (w529-2)
• Backbone manufacturer: Eric Campeau Lab (Addgene Plasmid 19068)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: JNK Kinase Translocation Reporter (EE mutant)
• Species: H. sapiens (human), M. musculus (mouse)
• Promoter: PGK
• Tag / Fusion Protein:
  • mClover (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ACCGAATCACCGACCTCTCT
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• Supplemental Documents:
  • psr1759-pgk_jnkktree-mutant-mclover_puro.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

JNKKTR EE has an M11I mutation compared to WT JNKKTR. The mutation does not alter plasmid function as described in the associated publication.