Skip to main content
Addgene

pLentiPGK Puro DEST p38KTRClover
(Plasmid #90233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLENTI PGK Puro DEST (w529-2)
  • Backbone manufacturer
    Eric Campeau Lab (Addgene Plasmid 19068)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    p38 Kinase Translocation Reporter
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Promoter PGK
  • Tag / Fusion Protein
    • mClover (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACCGAATCACCGACCTCTCT
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiPGK Puro DEST p38KTRClover was a gift from Markus Covert (Addgene plasmid # 90233)
  • For your References section:

    Live-cell measurements of kinase activity in single cells using translocation reporters. Kudo T, Jeknic S, Macklin DN, Akhter S, Hughey JJ, Regot S, Covert MW. Nat Protoc. 2018 Jan;13(1):155-169. doi: 10.1038/nprot.2017.128. Epub 2017 Dec 21. 10.1038/nprot.2017.128 PubMed 29266096