-
PurposeLentiviral vector to express ERK KTR mCerulean3 under PGK promoter (With Hygromycin Resistance)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLENTI PGK Hygro DEST
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameERK Kinase Translocation Reporter
-
SpeciesH. sapiens (human), M. musculus (mouse)
- Promoter PGK
-
Tag
/ Fusion Protein
- mCerulean3 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACCGAATCACCGACCTCTCT
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiPGK Hygro DEST ERKKTRmCerulean3 was a gift from Markus Covert (Addgene plasmid # 90229 ; http://n2t.net/addgene:90229 ; RRID:Addgene_90229) -
For your References section:
Live-cell measurements of kinase activity in single cells using translocation reporters. Kudo T, Jeknic S, Macklin DN, Akhter S, Hughey JJ, Regot S, Covert MW. Nat Protoc. 2018 Jan;13(1):155-169. doi: 10.1038/nprot.2017.128. Epub 2017 Dec 21. 10.1038/nprot.2017.128 PubMed 29266096